KRTAP10-8 cloning plasmid

  • Catalog number
    CSB-CL012602HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the KRTAP10-8 gene.
  • Specifications
    Gene name: KRTAP10-8; Gene ID: 386681; Accession number: BC127016; Vector: pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 780; Sequence: ATGGCTGACGCCTGCTGCACCAGGACGTATGTGATTGCTGCATCCACCATGTCTGTCTGCTCCAGTGACGTGGGCCGTGTCAGCCGAGTCTCCTCCCCCAGCACCTGCACTGGCTCCTCCTGGCAGGTGGACAATTGCCAGGAAAGCTGCTGCGAGCCCCGCTCCTGTGCCTCCAGCTGCTGTACCCCTAGCTGCTGTGCCCCAGCCCCCTGCCTGGCCCTGGTCTGTGCCCCAGTGAGCTGTGAGCCCAGCCCCTGCCAATCAGGCTGCACCGACTCCTGCACACCTTCATGCTGCCAGCAGTCTAGCTGCCAGCCGGCTTGCTGCACCTCCTCCCCCTGCCAACAGGCCTGCTGTGTGCCTGTGTGCTGCAAGTCCAACTGCTGCAAGCCCGTGTGCTGCGTGTCCATCTGCTCTGGAGCTTCCTCCCCATGCTGCCAGCAGTCTAGCTGCCAGTCAGCTTGCTGCACCTTCTCCCCATGCCAACAGGCCTGCTGTGTGCCCATCTGCTGCAAGCCCATCTGCTGTGTGCCTGTCTGCTCTGGGGCTTCCTCTCTGTGCTGCCAGAAGTCTAGCTGCCAGCCGGCTTGCTGCACCACCTCCTGCTGCAGACCCTCCTCCTCCGTGTCCCTCCTCTGCCGCCCTGTGTGCCGGCCTGCCTGCTGTGTGCCTGTCCCCTCCTGTTGTGTCCCTGCCTCCTCCTGCCAGCCCAGCTGCTGCCACCCGGCCTCCTGCCTGTCCTTCCTCTGCCGCCCCGCGTGCTCCCGCCTGGCCTGCTGA
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
  • Gene symbol
    KRTAP10-8, KRTAP10-13P, SNORD114-8, RNU6-8, SNORD113-8, SNORD116-8, IGKV2OR2-8, MIR1302-8, PIRC35
  • Short name
    KRTAP10-8 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    KRTAP10-8 cloning plasmid
  • Alternative technique
    plasmids
Gene info
Gene info
Gene info
Gene info
Gene info
Gene info
Gene info
  • Identity
  • Gene
  • Long gene name
    immunoglobulin kappa variable 2/OR2-8 (pseudogene)
  • Synonyms gene name
    • immunoglobulin kappa variable 2/OR2-8
    • immunoglobulin kappa variable 2/OR2-8 pseudogene
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2000-04-18
  • Entrez gene record
  • RefSeq identity
  • Classification
    • Immunoglobulin kappa (IGK) orphons
Gene info
Gene info
  • Identity
  • Gene
  • Long gene name
    piwi-interacting RNA cluster 35
  • Locus
    8
  • Discovery year
    2009-11-05
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • Piwi-interacting RNA clusters
Similar products
Filters
Contact
Chat with gentaur.com employee