AGBL4 cloning plasmid

#
  • Catalog number
    CSB-CL713349HU-10ug
  • Price:

    Please ask

    Ask for price
  • Size
    10ug
# #
  • Description
    A cloning plasmid for the AGBL4 gene.
  • Specifications
    Gene name: AGBL4; Gene ID: 84871; Accession number: BC126383; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 807; Sequence: atggattacttctttcgggagcagctgggccagagtgtgcaacaacgaaagcttgacctcctgacgataaccagccctgacaatctccgggaaggggcagagcagaaggtggtattcatcacaggacgagtccacccaggggaaacaccctcatcatttgtgtgccaagggatcattgacttccttgtaagccagcaccctattgcctgtgtcctccgggaatacctggtcttcaagatcgcaccaatgctcaatcctgatggagtctacctgggcaattacaggtgttctctgatgggatttgatctgaatcgtcactggctggatccctctccatgggtccatcctaccctgcatggagtgaaacaactcatcgtccagatgtacaacgacccaaaaacaagcctggagttttatattgacatccatgcccactccaccatgatgaatggcttcatgtatggcaacatctttgaggatgaggaacggttccagaggcaggccatttttcccaagctcctctgccagaatgctgaggacttctcctattccagcacatcctttaaccgggacgctgtgaaagcaggaactggccgtcgcttcctcggtggactcctggaccacacttcctattgctacaccctagaggtctccttctacagctacatcatcagtggcaccacggctgctgtgccctacactgaagaagcctgtatccttagtccccacccagccttgggccagccctcatccagccgagagtatccaagtctgacaggtcaggaattaggcccccagctcaggtaa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
#
  • Gene target
    AGBL4   cloning  
  • Gene symbol
    AGBL4-IT1, AGBL4-AS1, AGBL4
  • Short name
    AGBL4 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    AGBL4 cloning plasmid
  • Alternative technique
    plasmids
Gene info
  • Identity
  • Gene
  • Long gene name
    AGBL4 intronic transcript 1
  • Synonyms gene name
    • AGBL4 intronic transcript 1 (non-protein coding)
  • Locus
  • Discovery year
    2011-06-08
  • Classification
    • Intronic transcripts
  • VEGA ID
Gene info
Gene info
Similar products
Filters
Contact
Chat with gentaur.com employee