Filters
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing

LIMD2 cloning plasmid

LIMD2 cloning plasmid is available 1 time from Cusabio labs

CSB-CL861131HU-10ug | LIMD2 cloning plasmid size: 10ug | 282.47 USD

Catalog number CSB-CL861131HU-10ug
Supplier Cusabio
Price 282.47 USD
Size 10ug
1. Gene info
Identity 28142
Gene LIMD2
Long gene name LIM domain containing 2
Synonyms
  • MGC10986
GenBank acession
  • AK092301
Locus 17q23.3
Discovery year 2006-01-24
Entrez gene record 80774
Pubmed identfication
  • 12477932
RefSeq identity
  • NM_030576
Classification
  • LIM domain containing
Havana BLAST/BLAT OTTHUMG00000178907
Product images
    #.png
Product files
Description A cloning plasmid for the LIMD2 gene.
Specifications Gene name: LIMD2; Gene ID: 80774; Accession number: BC004400; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Additional_information Formulation: 10 μg plasmid + 200μl Glycerol; Length: 384; Sequence: atgttccaggctgcaggagccgcccaggccaccccctctcatgacgccaaaggcggcggcagcagcacggtgcagcgctccaagtccttcagcctgcgggcccaggtgaaggagacctgcgccgcctgccagaagaccgtgtaccccatggagcggctggtggccgacaagctcattttccacaactcttgcttctgctgcaagcactgtcacaccaagctcagcctgggcagctacgccgcgctgcacggggagttctactgcaaaccccacttccagcagctgtttaagagcaaaggcaactacgacgaggggtttggccgcaagcagcacaaggagctctgggcccacaaggaggtggaccccggcaccaagacggcctga
Storage_and_shipping Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
Notes For research use only.
Kit Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
Gene targetLIMD2 cloning
Short name LIMD2 cloning plasmid
Technique plasmid
Alternative name LIMD2 cloning plasmid
Alternative technique plasmids
Similar products
anti TXNL4B DIM2 1 149 His tag Antibody Suppplier: acr
Price: 711.62 USD
Bovine Tight junction protein ZO-1(TJP1) ELISA Kit Suppplier: Enlibio
Price: 543.11 USD
Mitofusin 2 Primary Antibody Suppplier: EnoGene
Price: 515.23 USD
CF647 maleimide Suppplier: biotiom
Price: 362.96 USD
HoxB4 Polyclonal Antibody Suppplier: Abbkine
Price: 339.44 USD
Human Recombinant Ubiquitin K11R Suppplier: Biovision
Price: 301.86 USD
Epithelial Cell Adhesion Molecule EPCAM Monoclonal Antibody Human Suppplier: Cloud Clone Corp
Price: 259.43 USD
IL18RAP Polyclonal Antibody Suppplier: MyBioSource
Price: 208.52 USD
Recombinant Serine protein kinase rsbW rsbW Suppplier: MyBioSource
Price: 6.06 USD
Pdcd5 3 UTR Lenti reporter Suppplier: ABM microrna
Price: 0.00 USD
C7orf42 cDNA Clone Suppplier: MyBioSource
Price: 0.00 USD
2,4-Dimethoxybenzenesulfonyl Chloride Suppplier: SFC
Price: 0.00 USD
Ask
Ajax processing
Close
LIMD2 cloning plasmid | Technique alternative | 01018141027
Filters
EU:+32-(0)1-658-90-45 US:+1-(408)780-0908 [email protected]
  • LIMD2
  • cloning
Back
Contact us
Ajax processing
Close
Chat with gentaur.com employee