Filters
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing

LDHC cloning plasmid

LDHC cloning plasmid is available 1 time from Cusabio labs

CSB-CL012844HU-10ug | LDHC cloning plasmid size: 10ug | 282.51 USD

Catalog number CSB-CL012844HU-10ug
Supplier Cusabio
Price 282.51 USD
Size 10ug
1. Gene info
Identity 6544
Gene LDHC
Long gene name lactate dehydrogenase C
Synonyms
  • CT32
Synonyms name
  • cancer/testis antigen 32
GenBank acession
  • AY286300
Locus 11p15.1
Discovery year 2001-06-22
Entrez gene record 3948
RefSeq identity
  • NM_017448
Havana BLAST/BLAT OTTHUMG00000167722
Product images
    #.png
Product files
Description A cloning plasmid for the LDHC gene.
Specifications Gene name: LDHC; Gene ID: 3948; Accession number: BC064388; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Additional_information Formulation: 10 μg plasmid + 200μl Glycerol; Length: 999; Sequence: atgtcaactgtcaaggagcagctaattgagaagctaattgaggatgatgaaaactcccagtgtaaaattactattgttggaactggtgccgtaggcatggcttgtgctattagtatcttactgaaggatttggctgatgaacttgcccttgttgatgttgcattggacaaactgaagggagaaatgatggatcttcagcatggcagtcttttctttagtacttcaaagattacttctggaaaagattacagtgtatctgcaaactccagaatagttattgtcacagcaggtgcaaggcagcaggagggagaaactcgccttgccctggtccaacgtaatgtggctataatgaaatcaatcattcctgccatagtccattatagtcctgattgtaaaattcttgttgtttcaaatccagtggatattttgacatatatagtctggaagataagtggcttacctgtaactcgtgtaattggaagtggttgtaatctagactctgcccgtttccgttacctaattggagaaaagttgggtgtccaccccacaagctgccatggttggattattggagaacatggtgattctagtgtgcccttatggagtggggtgaatgttgctggtgttgctctgaagactctggaccctaaattaggaacggattcagataaggaacactggaaaaatatccataaacaagttattcaaagtgcctatgaaattatcaagctgaaggggtatacctcttgggctattggactgtctgtgatggatctggtaggatccattttgaaaaatcttaggagagtgcacccagtttccaccatggttaagggattatatggaataaaagaagaactctttctcagtatcccttgtgtcttggggcggaatggtgtctcagatgttgtgaaaattaacttgaattctgaggaggaggcccttttcaagaagagtgcagaaacactttggaatattcaaaaggatctaatattttaa
Storage_and_shipping Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
Notes For research use only.
Kit Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
Gene targetLDHC cloning
Short name LDHC cloning plasmid
Technique plasmid
Alternative name LDHC cloning plasmid
Alternative technique plasmids
Similar products
Human C Mer Proto Oncogene Tyrosine Kinase MERTK ELISA Kit Suppplier: Cloud Clone Corp
Price: 776.00 USD
Human S100 Calcium Binding Protein A2 S100A2 ELISA Kit Suppplier: Cloud Clone Corp
Price: 776.00 USD
SSTR1 Primary Antibody Suppplier: EnoGene
Price: 454.69 USD
RSAD2 Rabbit pAb Suppplier: EnoGene
Price: 453.48 USD
ALKBH8 polyclonal antibody Suppplier: Bioworld
Price: 434.08 USD
Profilin 1 recombinant human no tag Suppplier: Cytoskelton
Price: 402.55 USD
Alpha 1 Acid Glycoprotein Antibody Suppplier: Bioss Primary Unconjugated Antibodies
Price: 318.89 USD
Rabbit SOS1 Polyclonal Antibody Suppplier: ABclonal
Price: 281.30 USD
Human brain S100 beta S100B antibody Suppplier: Absea Antibody
Price: 281.30 USD
Recombinant Chicken Polycomb complex protein BMI 1 BMI1 Suppplier: MyBioSource
Price: 6.06 USD
TRAJ12 3'UTR GFP Stable Cell Line Suppplier: ABM microrna
Price: 2 638.40 USD
Chicken Carbonic anhydrase 2, CA2 ELISA KIT Suppplier: Lifescience Market
Price: 1 125.20 USD
Rhodococcus opacus Nucleoside diphosphate kinase ndk Suppplier: MBS Recombinant
Price: 1 782.38 USD
Anti-Human NT-3 Suppplier: genways bulk
Price: 0.00 USD
Recombinant Rat Small Suppplier: MyBioSource
Price: 0.00 USD
Ask
Ajax processing
Close
LDHC cloning plasmid | Technique alternative | 01018143659
Filters
EU:+32-(0)1-658-90-45 US:+1-(408)780-0908 [email protected]
  • LDHC
  • cloning
Back
Contact us
Ajax processing
Close
Chat with gentaur.com employee