Filters
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing

STAT2 cloning plasmid

STAT2 cloning plasmid is available 1 time from Cusabio labs

CSB-CL022811HU-10ug | STAT2 cloning plasmid size: 10ug | 978.12 USD

Catalog number CSB-CL022811HU-10ug
Supplier Cusabio
Price 978.12 USD
Size 10ug
1. Gene info
Identity 11363
Gene STAT2
Long gene name signal transducer and activator of transcription 2
Synonyms gene name
  • signal transducer and activator of transcription 2, 113kD
  • signal transducer and activator of transcription 2, 113kDa
Synonyms
  • STAT113
GenBank acession
  • BC051284
Locus 12q13.3
Discovery year 1995-11-08
Entrez gene record 6773
Pubmed identfication
  • 7885841
RefSeq identity
  • NM_005419
Classification
  • SH2 domain containing
Havana BLAST/BLAT OTTHUMG00000170760
Locus Specific Databases
  • LRG_1329
Product images
    #.png
Product files
Description A cloning plasmid for the STAT2 gene.
Specifications Gene name: STAT2; Gene ID: 6773; Accession number: BC051284; Vector: pUC
Additional_information Formulation: 10 μg plasmid + 200μl Glycerol; Length: 2556; Sequence: atggcgcagtgggaaatgctgcagaatcttgacagcccctttcaggatcagctgcaccagctttactcgcacagcctcctgcctgtggacattcgacagtacttggctgtctggattgaagaccagaactggcaggaagctgcacttgggagtgatgattccaaggctaccatgctattcttccacttcttggatcagctgaactatgagtgtggccgttgcagccaggacccagagtccttgttgctgcagcacaatttgcggaaattctgccgggacattcagcccttttcccaggatcctacccagttggctgagatgatctttaacctccttctggaagaaaaaagaattttgatccaggctcagagggcccaattggaacaaggagagccagttctcgaaacacctgtggagagccagcaacatgagattgaatcccggatcctggatttaagggctatgatggagaagctggtaaaatccatcagccaactgaaagaccagcaggatgtcttctgcttccgatataagatccaggccaaagggaagacaccctctctggacccccatcagaccaaagagcagaagattctgcaggaaactctcaatgaactggacaaaaggagaaaggaggtgctggatgcctccaaagcactgctaggccgattaactaccctaatcgagctactgctgccaaagttggaggagtggaaggcccagcagcaaaaagcctgcatcagagctcccattgaccacgggttggaacagctggagacatggttcacagctggagcaaagctgttgtttcacctgaggcagctgctgaaggagctgaagggactgagttgcctggttagctatcaggatgaccctctgaccaaaggggtggacctacgcaacgcccaggtcacagagttgctacagcgtctgctccacagagcctttgtggtagaaacccagccctgcatgccccaaactccccatcgacccctcatcctcaagactggcagcaagttcaccgtccgaacaaggctgctggtgagactccaggaaggcaatgagtcactgactgtggaagtctccattgacaggaatcctcctcaattacaaggcttccggaagttcaacattctgacttcaaaccagaaaactttgacccccgagaaggggcagagtcagggtttgatttgggactttggttacctgactctggtggagcaacgttcaggtggttcaggaaagggcagcaataaggggccactaggtgtgacagaggaactgcacatcatcagcttcacggtcaaatatacctaccagggtctgaagcaggagctgaaaacggacaccctccctgtggtgattatttccaacatgaaccagctctcaattgcctgggcttcagttctctggttcaatttgctcagcccaaaccttcagaaccagcagttcttctccaacccccccaaggccccctggagcttgctgggccctgctctcagttggcagttctcctcctatgttggccgaggcctcaactcagaccagctgagcatgctgagaaacaagctgttcgggcagaactgtaggactgaggatccattattgtcctgggctgacttcactaagcgagagagccctcctggcaagttaccattctggacatggctggacaaaattctggagttggtacatgaccacctgaaggatctctggaatgatggacgcatcatgggctttgtgagtcggagccaggagcgccggctgctgaagaagaccatgtctggcacctttctactgcgcttcagtgaatcgtcagaagggggcattacctgctcctgggtggagcaccaggatgatgacaaggtgctcatctactctgtgcaaccgtacacgaaggaggtgctgcagtcactcccgctgactgaaatcatccgccattaccagttgctcactgaggagaatatacctgaaaacccactgcgcttcctctatccccgaatcccccgggatgaagcttttgggtgctactaccaggagaaagttaatctccaggaacggaggaaatacctgaaacacaggctcattgtggtctctaatagacaggtggatgaactgcaacaaccgctggagcttaagccagagccagagctggagtcattagagctggaactagggctggtgccagagccagagctcagcctggacttagagccactgctgaaggcagggctggatctggggccagagctagagtctgtgctggagtccactctggagcctgtgatagagcccacactatgcatggtatcacaaacagtgccagagccagaccaaggacctgtatcacagccagtgccagagccagatttgccctgtgatctgagacatttgaacactgagccaatggaaatcttcagaaactgtgtaaagattgaagaaatcatgccgaatggtgacccactgttggctggccagaacaccgtggatgaggtttacgtctcccgccccagccacttctacactgatggacccttgatgccttctgacttctag
Storage_and_shipping Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
Notes For research use only.
Kit Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
Gene targetSTAT2 cloning
Short name STAT2 cloning plasmid
Technique plasmid
Alternative name signal transducer and activator on transcription 2, 113kDa cloning plasmid
Alternative technique plasmids
Alternative to gene target signal transducer and activator of transcription 2, 113kDa, ISGF-3 and P113 and STAT113, STAT2 and IDBG-40906 and ENSG00000170581 and 6773, identical protein binding, nuclei, Stat2 and IDBG-197036 and ENSMUSG00000040033 and 20847, STAT2 and IDBG-635999 and ENSBTAG00000004380 and 511023
Similar products
Fish NK-Tumor Recognition Protein (NKTR) ELISA Kit Suppplier: MyBioSource
Price: 629.55 USD
TCIRG1 Primary Antibody Suppplier: EnoGene
Price: 503.88 USD
AMELX Antibody Suppplier: EnoGene
Price: 503.88 USD
Anti-SMAP2 antibody Suppplier: Lifescience Market
Price: 457.64 USD
Anti BAI1 Specific Antibody Suppplier: MBS Polyclonals
Price: 314.18 USD
COL4A6 Antibody Suppplier: MyBioSource
Price: 262.02 USD
DCTN4 Antibody Suppplier: Elabscience
Price: 128.00 USD
Tramadol (BSA)[Tramadol] Suppplier: MyBioSource
Price: 5.93 USD
FSGS1 3'UTR GFP Stable Cell Line Suppplier: ABM microrna
Price: 2 579.87 USD
CYCSP16 3'UTR Luciferase Stable Cell Line Suppplier: ABM microrna
Price: 2 579.87 USD
Mbl2/ Rat Mbl2 ELISA Kit Suppplier: Lifescience Market
Price: 1 050.44 USD
Recombinant Clostridium Kluyveri trpC Protein aa 1 262 Suppplier: Creative Biolabs
Price: 1 653.91 USD
Human MYC Antibody Suppplier: genways bulk
Price: 0.00 USD
TIGD1 cDNA Clone Suppplier: MyBioSource
Price: 0.00 USD
Ask
Ajax processing
Close
STAT2 cloning plasmid | Technique alternative | 01018138853
Filters
EU:+32-(0)1-658-90-45 US:+1-(408)780-0908 [email protected]
  • STAT2
  • cloning
Back
Contact us
Ajax processing
Close
Chat with gentaur.com employee