gentaur logogentaur logo
x

HNMT cloning plasmid

  • Catalog number
    CSB-CL010598HU1-10ug
  • Product name
    HNMT cloning plasmid
  • Size
    10ug
  • Description
    A cloning plasmid for the HNMT gene.
  • Specifications
    Gene name: HNMT; Gene ID: 3176; Accession number: BC005907; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 156; Sequence: atggcatcttccatgaggagcttgttttctgaccacgggaaatatgttgaatctttccggaggtttctcaaccattccacggaacaccagtgcatgcaggaattcatggacaagaagctgccaggcataataggaagataccagaattgctgttaa
  • Storage and shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Alternative to gene target
    • [ "histamine N-methyltransferase", "HMT and HNMT-S1 and HNMT-S2", "HNMT and IDBG-71109 and ENSG00000150540 and 3176", "histamine N-methyltransferase activity", "nuclei", "Hnmt and IDBG-141972 and ENSMUSG00000026986 and 140483", "HNMT and IDBG-642173 and ENSBTAG00000014432 and 613413" ]
  • Gene target
    HNMT cloning
    • Gene info
    • Identity:HGNC:5028
    • Gene:HNMT
    • Long gene name:histamine N-methyltransferase
    • Discovery year:1994-04-18
    • Entrez gene record:3176
    • Classification:7BS small molecule methyltransferases
    • VEGA ID:OTTHUMG00000131751
  • Gene symbol
    HNMT
  • Short name
    HNMT cloning plasmid
  • technique filter
    • plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative technique
    plasmids