HNMT cloning plasmid

Description

A cloning plasmid for the HNMT gene.
Specifications

Gene name: HNMT; Gene ID: 3176; Accession number: BC005907; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Additional_information

Formulation: 10 μg plasmid + 200μl Glycerol; Length: 156; Sequence: atggcatcttccatgaggagcttgttttctgaccacgggaaatatgttgaatctttccggaggtttctcaaccattccacggaacaccagtgcatgcaggaattcatggacaagaagctgccaggcataataggaagataccagaattgctgttaa
Storage_and_shipping

Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
Notes

For research use only.
Kit

Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

Gene target

HNMT cloning
Gene symbol

HNMT
Short name

HNMT cloning plasmid
Technique

plasmid, plasmids in 1
Alternative name

histamine N-methyltransferase cloning plasmid
Alternative technique

plasmids
Alternative to gene target

histamine N-methyltransferase, HMT and HNMT-S1 and HNMT-S2, HNMT and IDBG-71109 and ENSG00000150540 and 3176, histamine N-methyltransferase activity, nuclei, Hnmt and IDBG-141972 and ENSMUSG00000026986 and 140483, HNMT and IDBG-642173 and ENSBTAG00000014432 and 613413