gentaur logogentaur logo
x

ANGPT1 cloning plasmid

  • Catalog number
    CSB-CL622996HU-10ug
  • Product name
    ANGPT1 cloning plasmid
  • Size
    10ug
  • Description
    A cloning plasmid for the ANGPT1 gene.
  • Specifications
    Gene name: ANGPT1; Gene ID: 284; Accession number: BC029406; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 444; Sequence: atggacacagtccacaaccttgtcaatctttgcactaaagaagttttactaaagggaggaaaaagagaggaagagaaaccatttagagactgtgcagatgtatatcaagctggttttaataaaagtggaatctacactatttatattaataatatgccagaacccaaaaaggtgttttgcaatatggatgtcaatgggggaggttggactgtaatacaacatcgtgaagatggaagtctagatttccaaagaggctggaaggaatataaaatgggttttggaaatccctccggtgaatattggctggggaatgagtttatttttgccattaccagtcagaggcagtacatgctaagaattgagttaatggactgggaagggaaccgagcctattcacagtatgacagattccacataggaaatgaaaagcaaaactataggtaa
  • Storage and shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Alternative to gene target
    • [ "angiopoietin 1", "AGP1 and AGPT and ANG1", "ANGPT1 and IDBG-32292 and ENSG00000154188 and 284", "receptor tyrosine kinase binding", "Extracellular", "Angpt1 and IDBG-137812 and ENSMUSG00000022309 and 11600", "ANGPT1 and IDBG-644947 and ENSBTAG00000014051 and 282140" ]
  • Gene target
    ANGPT1 cloning
    • Gene info
  • Gene symbol
    ANGPT1
  • Short name
    ANGPT1 cloning plasmid
  • technique filter
    • plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative technique
    plasmids