pGB Caspase-8 siRNA Vector
-
Catalog number
9508-60
-
Price
Please ask
-
Size
60 μg
-
-
Description
pGB expression vector to supress Caspase 8 activity in transfected cells. pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. The pGB vector is used to clone your own insert. The vector contains two unique restriction sites, BamH I and Xba I for directional cloning. The pGB Negative Control vector contains a insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and it can be used as a negative control for pGB-Caspase siRNA vectors. The pGB Caspase siRNA vectors contain the siRNA inserts designed to suppress the expression of each caspase individually
-
Product Highlights
• (GeneBlocker™ Caspase-8 siRNA Vector, pGB-Casp-8) • Application- The pGB siRNA vectors can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked.The pGB cloning vector is designed for cloning your own siRNA insert. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003
-
Storage Temp
-20°C
-
Shipping
gel pack
-
Shelf Life
12 months
-
-
Notes
For research use only. Not to be used for human or animal treatment or consumption.
-
Additional description
Human and some mouse caspases are active in apoptosis and cell death and even in necrosis and inflammation. CASP Gene and orthologous enzymes have been identifies successfully in the signal transduction cascade and pathways.
MeSH Data
-
Name
-
Concept
Scope note:
Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.
-
Tree numbers
Product images
Similar products