PTPRF cloning plasmid

• Catalog number
  CSB-CL019053HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the PTPRF gene.
• Specifications
  Gene name: PTPRF; Gene ID: 5792; Accession number: BC012102; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1044; Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggagaacccaagccgcgcatcacatggatgaagaaggggaagaaagtcagctcccagcgcttcgaggtcattgagtttgatgatggggcagggtcagtgcttcggatccagccattgcgggtgcagcgagatgaagccatctatgagtgtacagctactaacagcctgggtgagatcaacactagtgccaagctctcagtgctcgaagaggaacagctgccccctgggttcccttccatcgacatggggcctcagctgaaggtggtggagaaggcacgcacagccaccatgctatgtgctgcaggcggaaatccagaccctgagatttcttggttcaaggacttccttcctgtagaccctgccacgagcaacggccgcatcaagcagctgcgttcaggtgccttgcagatagagagcagtgaggaatccgaccaaggcaagtacgagtgtgtggcgaccaactcggcaggcacacgttactcagcccctgcgaacctgtatgtgcgaggtaaggactcaggcagtgcctggcccctgtcaccacagagctgtgctgcacctgccgggctctctgcccagagcccttggtgcagacacgcaagggactgccatgggcccagtctcttctccttcctgcttctttctgcagcagcagcaacagctcccactgggcaagttcctggcgtctgccactacttcgccttccttccttgcaggcccatggggaagcagccactcttgggagcatttgtatcttttgtaggtcttgccgcatgggcccggagccccatgggaatttggagccatccaatccgacttcttggtgtatgtgcatgtgtgtgtgcacacacgggcacacttatctgtgtgtaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  PTPRF   cloning  
• Gene symbol
  PTPRF
• Short name
  PTPRF cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  protein tyrosine phosphatase, receptor classification, F cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  protein tyrosine phosphatase, receptor type, F, BNAH2 and LAR, PTPRF and IDBG-97490 and ENSG00000142949 and 5792, protein complex binding, Plasma membranes, Ptprf and IDBG-180768 and ENSMUSG00000033295 and 19268, PTPRF and IDBG-640420 and ENSBTAG00000000253 and 512072

Gene info

• Identity
  HGNC:9670
• Gene
  PTPRF
• Long gene name
  protein tyrosine phosphatase receptor type F
• Synonyms gene
  • LAR
• GenBank acession
  • Y00815
• Locus
  1p34.2
• Discovery year
  1989-06-30
• Entrez gene record
  5792
• Pubmed identfication
  • 7558042
• Classification
  • Protein tyrosine phosphatases receptor type
  • Fibronectin type III domain containing
  • I-set domain containing
• VEGA ID
  OTTHUMG00000007501

Similar products