BTG4 cloning plasmid

  • Catalog number
    CSB-CL878918HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the BTG4 gene.
  • Specifications
    Gene name: BTG4; Gene ID: 54766; Accession number: BC031045; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 621; Sequence: atgagagatgaaattgcaacaacagttttctttgtcacaagattggtgaaaaaacatgataaactaagtaaacagcaaatagaagactttgcagaaaagctgatgacgatcttgtttgaaacatacagaagtcactggcactctgattgcccttctaaagggcaagccttcaggtgcatcaggataaacaacaatcagaataaagatcccattctagaaagggcatgtgtggaaagtaatgtagatttttctcacctgggacttccgaaggagatgaccatatgggtagatccctttgaagtatgctgtaggtatggtgagaaaaaccatccatttacagttgcttcttttaaaggcagatgggaggaatgggaactatatcaacaaatcagttatgcagttagtagagcctcatcagacgtttcctctggcacttcctgcgatgaagaaagttgtagcaaggaacctcgtgtcattcctaaagtcagcaatccgaagagtatttatcaggtcaagagtgttccagttcttttctatactttttttctatctaattctaaaaagaatgcactcattatgaaaacaaagaagcaaaaaaacatggaaagaacaaaactgtag
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    BTG4   cloning  
  • Gene symbol
    BTG4
  • Short name
    BTG4 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    B-cellular translocation gene 4 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    B-cell translocation gene 4, BTG4 and IDBG-70797 and ENSG00000137707 and 54766, multiple, Btg4 and IDBG-164716 and ENSMUSG00000032056 and 56057, BTG4 and IDBG-630144 and ENSBTAG00000034346 and 519995
Gene info
  • Identity
  • Gene
  • Long gene name
    BTG anti-proliferation factor 4
  • Synonyms gene name
    • B-cell translocation gene 4
    • BTG family member 4
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2000-11-15
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • BTG/Tob family
    • MicroRNA protein coding host genes
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee