DEFA1 cloning plasmid
-
Catalog numberCSB-CL006652HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the DEFA1 gene.
-
SpecificationsGene name: DEFA1; Gene ID: 1667; Accession number: BC069423; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 285; Sequence: atgaggaccctcgccatccttgctgccattctcctggtggccctgcaggcccaggctgagccactccaggcaagagctgatgaggttgctgcagccccggagcagattgcagcggacatcccagaagtggttgtttcccttgcatgggacgaaagcttggctccaaagcatccaggctcaaggaaaaacatggcctgctattgcagaataccagcgtgcattgcaggagaacgtcgctatggaacctgcatctaccagggaagactctgggcattctgctgctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolDEFA1A3, DEFA1
-
Short nameDEFA1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namedefensin, alpha 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetdefensin, alpha 1, DEFA1 and IDBG-6083 and ENSG00000206047 and 1667,728358, Extracellular
-
Gene info
-
Identity
-
Gene
-
Long gene namedefensin alpha 1 and alpha 3, variable copy number locus
-
Synonyms gene name
- defensin, alpha 1 and alpha 3, variable copy number locus
-
Synonyms
-
Locus
-
Discovery year2005-08-31
-
Pubmed identfication
-
Classification
- Defensins, alpha
Gene info
-
Identity
-
Gene
-
Long gene namedefensin alpha 1
-
Synonyms gene
-
Synonyms gene name
- defensin, alpha 2
- defensin, alpha 1, myeloid-related sequence
- defensin, alpha 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1988-06-27
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Defensins, alpha
-
VEGA ID