pGB Caspase-1 siRNA Vector

  • Catalog number
    9501-60
  • Price
    Please ask
  • Size
    60 μg
  • Description
    pGB expression vector to supress Caspase 1 activity in transfected cells. pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. The pGB vector is used to clone your own insert. The vector contains two unique restriction sites, BamH I and Xba I for directional cloning. The pGB Negative Control vector contains a insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and it can be used as a negative control for pGB-Caspase siRNA vectors. The pGB Caspase siRNA vectors contain the siRNA inserts designed to suppress the expression of each caspase individually
  • Product Highlights
    • (GeneBlocker™ Caspase-1 siRNA Vector, pGB-Casp-1) • Application- The pGB siRNA vectors can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked.The pGB cloning vector is designed for cloning your own siRNA insert. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003
  • Storage Temp
    -20°C
  • Shipping
    gel pack
  • Shelf Life
    12 months
  • Notes
    For research use only. Not to be used for human or animal treatment or consumption.
  • Additional description
    Human and some mouse caspases are active in apoptosis and cell death and even in necrosis and inflammation. CASP Gene and orthologous enzymes have been identifies successfully in the signal transduction cascade and pathways.
  • Gene target
    pGB   Caspase-1   siRNA   Vector  
  • Short name
    pGB Caspase-1 siRNA Vector
  • Technique
    sirna, Vectors
  • Alternative name
    pGB caspase-1 small interfearing RNA integrating Desoxyribonucleic acid sequence
MeSH Data
  • Name
  • Concept
    Scope note: The transfer of bacterial DNA by phages from an infected bacterium to another bacterium. This also refers to the transfer of genes into eukaryotic cells by viruses. This naturally occurring process is routinely employed as a GENE TRANSFER TECHNIQUE.
  • Tree numbers
    • E05.393.350.800
  • Qualifiers
    ethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data
Product images
Similar products
Filters
Contact
Chat with gentaur.com employee