TCL1A cloning plasmid
-
Catalog numberCSB-CL023313HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TCL1A gene.
-
SpecificationsGene name: TCL1A; Gene ID: 8115; Accession number: BC003574; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 345; Sequence: atggccgagtgcccgacactcggggaggcagtcaccgaccacccggaccgcctgtgggcctgggagaagttcgtgtatttggacgagaagcagcacgcctggctgcccttaaccatcgagataaaggataggttacagttacgggtgctcttgcgtcgggaagacgtcgtcctggggaggcctatgacccccacccagataggcccaagcctgctgcctatcatgtggcagctctaccctgatggacgataccgatcctcagactccagtttctggcgcttagtgtaccacatcaagattgacggcgtggaggacatgcttctcgagctgctgccagatgactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTCL1A
-
Short nameTCL1A cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameT-cellular leukemia/lymphoma 1A cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetT-cell leukemia/lymphoma 1A, TCL1, TCL1A and IDBG-18937 and ENSG00000100721 and 8115, protein binding, nuclei, Tcl1 and IDBG-169124 and ENSMUSG00000041359 and 21432, TCL1A and IDBG-634173 and ENSBTAG00000019580 and 506540
-
Gene info
-
Identity
-
Gene
-
Long gene nameTCL1 family AKT coactivator A
-
Synonyms gene name
- T cell leukemia/lymphoma 1A
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-12-03
-
Entrez gene record
-
Pubmed identfication
-
VEGA ID