CXCR3 cloning plasmid

• Catalog number
  CSB-CL006253HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CXCR3 gene.
• Specifications
  Gene name: CXCR3; Gene ID: 2833; Accession number: BC034403; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1107; Sequence: atggtccttgaggtgagtgaccaccaagtgctaaatgacgccgaggttgccgccctcctggagaacttcagctcttcctatgactatggagaaaacgagagtgactcgtgctgtacctccccgccctgcccacaggacttcagcctgaacttcgaccgggccttcctgccagccctctacagcctcctctttctgctggggctgctgggcaacggcgcggtggcagccgtgctgctgagccggcggacagccctgagcagcaccgacaccttcctgctccacctagctgtagcagacacgctgctggtgctgacactgccgctctgggcagtggacgctgccgtccagtgggtctttggctctggcctctgcaaagtggcaggtgccctcttcaacatcaacttctacgcaggagccctcctgctggcctgcatcagctttgaccgctacctgaacatagttcatgccacccagctctaccgccgggggcccccggcccgcgtgaccctcacctgcctggctgtctgggggctctgcctgcttttcgccctcccagacttcatcttcctgtcggcccaccacgacgagcgcctcaacgccacccactgccaatacaacttcccacaggtgggccgcacggctctgcgggtgctgcagctggtggctggctttctgctgcccctgctggtcatggcctactgctatgcccacatcctggccgtgctgctggtttccaggggccagcggcgcctgcgggccatgcggctggtggtggtggtcgtggtggcctttgccctctgctggaccccctatcacctggtggtgctggtggacatcctcatggacctgggcgctttggcccgcaactgtggccgagaaagcagggtagacgtggccaagtcggtcacctcaggcctgggctacatgcactgctgcctcaacccgctgctctatgcctttgtaggggtcaagttccgggagcggatgtggatgctgctcttgcgcctgggctgccccaaccagagagggctccagaggcagccatcgtcttcccgccgggattcatcctggtctgagacctcagaggcctcctactcgggcttgtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CXCR3   cloning  
• Gene symbol
  CXCR3
• Short name
  CXCR3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  chemokine (C-X-C motif) receptor 3 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  chemokine (C-X-C motif) receptor 3, CD182 and CD183 and CKR-L2 and CMKAR3 and GPR9 and IP10-R and Mig-R and MigR, CXCR3 and IDBG-76333 and ENSG00000186810 and 2833, C-X-C chemokine binding, Cell surfaces, Cxcr3 and IDBG-164788 and ENSMUSG00000050232 and 12766, CXCR3 and IDBG-635748 and ENSBTAG00000014798 and 497018

Gene info

• Identity
  HGNC:4540
• Gene
  CXCR3
• Long gene name
  C-X-C motif chemokine receptor 3
• Synonyms gene
  • GPR9
• Synonyms gene name
  • G protein-coupled receptor 9
  • chemokine (C-X-C motif) receptor 3
• Synonyms
  • CKR-L2
  • CMKAR3
  • IP10-R
  • MigR
  • CD183
• GenBank acession
  • U32674
• Locus
  Xq13.1
• Discovery year
  1994-11-01
• Entrez gene record
  2833
• Pubmed identfication
  • 8666380
  • 9064356
• Classification
  • C-X-C motif chemokine receptors
  • CD molecules
• VEGA ID
  OTTHUMG00000033326

Product images

Similar products