SLAMF1 cloning plasmid

  • Catalog number
    CSB-CL614403HU3-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the SLAMF1 gene.
  • Specifications
    Gene name: SLAMF1; Gene ID: 6504; Accession number: BC132792; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1008; Sequence: atggatcccaaggggctcctctccttgaccttcgtgctgtttctctccctggcttttggggcaagctacggaacaggtgggcgcatgatgaactgcccaaagattctccggcagttgggaagcaaagtgctgctgcccctgacatatgaaaggataaataagagcatgaacaaaagcatccacattgtcgtcacaatggcaaaatcactggagaacagtgtcgagaacaaaatagtgtctcttgatccatccgaagcaggccctccacgttatctaggagatcgctacaagttttatctggagaatctcaccctggggatacgggaaagcaggaaggaggatgagggatggtaccttatgaccctggagaaaaatgtttcagttcagcgcttttgcctgcagttgaggctttatgagcaggtctccactccagaaattaaagttttaaacaagacccaggagaacgggacctgcaccttgatactgggctgcacagtggagaagggggaccatgtggcttacagctggagtgaaaaggcgggcacccacccactgaacccagccaacagctcccacctcctgtccctcaccctcggcccccagcatgctgacaatatctacatctgcaccgtgagcaaccctatcagcaacaattcccagaccttcagcccgtggcccggatgcaggacagacccctcagaaacaaaaccatgggcagtgtatgctgggctgttagggggtgtcatcatgattctcatcatggtggtaatactacagttgagaagaagaggtaaaacgaaccattaccagacaacagtggaaaaaaaaagccttacgatctatgcccaagtccagaaaccaggtcctcttcagaagaaacttgactccttcccagctcaggacccttgcaccaccatatatgttgctgccacagagcctgtcccagagtctgtccaggaaacaaattccatcacagtctatgctagtgtgacacttccagagagctga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    SLAMF1   cloning  
  • Gene symbol
    SLAMF1
  • Short name
    SLAMF1 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    signaling lymphocytic activation molecule family member 1 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    signaling lymphocytic activation molecule family member 1, CD150 and CDw150 and SLAM, SLAMF1 and IDBG-104073 and ENSG00000117090 and 6504, protein binding, Cell surfaces, Slamf1 and IDBG-204832 and ENSMUSG00000015316 and 27218, SLAMF1 and IDBG-630529 and ENSBTAG00000007927 and 281489
Gene info
  • Identity
  • Gene
  • Long gene name
    signaling lymphocytic activation molecule family member 1
  • Synonyms gene
  • Synonyms gene name
    • signaling lymphocytic activation molecule
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1998-08-06
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • CD molecules
    • Immunoglobulin like domain containing
    • Ig-like cell adhesion molecule family
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee