STAT5B cloning plasmid

• Catalog number
  CSB-CL022815HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the STAT5B gene.
• Specifications
  Gene name: STAT5B; Gene ID: 6777; Accession number: BC020868; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1173; Sequence: atggctgtgtggatacaagctcagcagctccaaggagaagcccttcatcagatgcaagcgttatatggccagcattttcccattgaggtgcggcattatttatcccagtggattgaaagccaagcatgggactcagtagatcttgataatccacaggagaacattaaggccacccagctcctggagggcctggtgcaggagctgcagaagaaggcagagcaccaggtgggggaagatgggtttttactgaagatcaagctggggcactatgccacacagctccagaacacgtatgaccgctgccccatggagctggtccgctgcatccgccatatattgtacaatgaacagaggttggtccgagaagccaacaatggtagctctccagctggaagccttgctgatgccatgtcccagaaacacctccagatcaaccagacgtttgaggagctgcgactggtcacgcaggacacagagaatgagttaaaaaagctgcagcagactcaggagtacttcatcatccagtaccaggagagcctgaggatccaagctcagtttggcccgctggcccagctgagcccccaggagcgtctgagccgggagacggccctccagcagaagcaggtgtctctggaggcctggttgcagcgtgaggcacagacactgcagcagtaccgcgtggagctggccgagaagcaccagaagaccctgcagctgctgcggaagcagcagaccatcatcctggatgacgagctgatccagtggaagcggcggcagcagctggccgggaacggcgggccccccgagggcagcctggacgtgctacagtcctggtgtgagaagttggccgagatcatctggcagaaccggcagcagatccgcagggctgagcacctctgccagcagctgcccatccccggcccagtggaggagatgctggccgaggtcaacgccaccatcacggacattatctcagccctggtgaccagcacgttcatcattgagaagcagcctcctcaggtcctgaagacccagaccaagtttgcagccactgtgcgcctgctggtgggcgggaagctgaacgtgcacatgaaccccccccaggtgaaggccaccatcatcagtgagcagcaggccaagtctctgctcaagaacgagaacacccgcaagtaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  STAT5B   cloning  
• Gene symbol
  STAT5B
• Short name
  STAT5B cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  signal transducer and activator on transcription 5B cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  signal transducer and activator of transcription 5B, STAT5, STAT5B and IDBG-50532 and ENSG00000173757 and 102723386,6777, protein dimerization activity, nuclei, Stat5b and IDBG-211594 and ENSMUSG00000020919 and 20851, STAT5B and IDBG-640180 and ENSBTAG00000010125 and 282376,789476

Gene info

• Identity
  HGNC:11367
• Gene
  STAT5B
• Long gene name
  signal transducer and activator of transcription 5B
• GenBank acession
  • BC065227
• Locus
  17q21.2
• Discovery year
  1997-01-28
• Entrez gene record
  6777
• Pubmed identfication
  • 8631883
• RefSeq identity
  • NM_012448
• Classification
  • SH2 domain containing
• VEGA ID
  OTTHUMG00000150724
• Locus Specific Databases
  • STAT5Bbase: Mutation registry for Growth hormone insensitivity with immunodeficiency
  • Global Variome shared LOVD
  • LRG_192

Similar products