Filters
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing

C10orf54 cloning plasmid

C10orf54 cloning plasmid is available 1 time from Cusabio labs

CSB-CL884484HU-10ug | C10orf54 cloning plasmid size: 10ug | 273.57 USD

Catalog number CSB-CL884484HU-10ug
Supplier Cusabio
Price 273.57 USD
Size 10ug
Product images
    #.png
Product files
Description A cloning plasmid for the C10orf54 gene.
Specifications Gene name: C10orf54; Gene ID: 64115; Accession number: BC020568; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Additional_information Formulation: 10 μg plasmid + 200μl Glycerol; Length: 936; Sequence: atgggcgtccccacggccctggaggccggcagctggcgctggggatccctgctcttcgctctcttcctggctgcgtccctaggtccggtggcagccttcaaggtcgccacgccgtattccctgtatgtctgtcccgaggggcagaacgtcaccctcacctgcaggctcttgggccctgtggacaaagggcacgatgtgaccttctacaagacgtggtaccgcagctcgaggggcgaggtgcagacctgctcagagcgccggcccatccgcaacctcacgttccaggaccttcacctgcaccatggaggccaccaggctgccaacaccagccacgacctggctcagcgccacgggctggagtcggcctccgaccaccatggcaacttctccatcaccatgcgcaacctgaccctgctggatagcggcctctactgctgcctggtggtggagatcaggcaccaccactcggagcacagggtccatggtgccatggagctgcaggtgcagacaggcaaagatgcaccatccaactgtgtggtgtacccatcctcctcccaggagagtgaaaacatcacggctgcagccctggctacgggtgcctgcatcgtaggaatcctctgcctccccctcatcctgctcctggtctacaagcaaaggcaggcagcctccaaccgccgtgcccaggagctggtgcggatggacagcaacattcaagggattgaaaaccccggctttgaagcctcaccacctgcccaggggatacccgaggccaaagtcaggcaccccctgtcctatgtggcccagcggcagccttctgagtctgggcggcatctgctttcggagcccagcacccccctgtctcctccaggccccggagacgtcttcttcccatccctggaccctgtccctgactctccaaactttgaggtcatctag
Storage_and_shipping Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
Notes For research use only.
Kit Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
Gene targetC10orf54 cloning
Short name C10orf54 cloning plasmid
Technique plasmid
Alternative name C10orf54 cloning plasmid
Alternative technique plasmids
Similar products
200ug Anti Ras polyclonal Antibody Suppplier: Cloud Clone Corp
Price: 799.56 USD
Assay kit for Protein Tyrosine Phosphatase ELISA Suppplier: BlueGen ELISAs
Price: 710.33 USD
PAb IgG to Human CCNA1 Cyclin A1 Suppplier: MBS Polyclonals
Price: 700.94 USD
POLR1A siRNA (Human) Suppplier: MyBioSource
Price: 531.87 USD
Gentaur Bafilomycin A, 1mg test Suppplier: Gentaur Genprice
Price: 496.64 USD
CATSPER3 Antibody - C-terminal region Suppplier: aviva
Price: 367.49 USD
5 Bromo 4 chloro 2 methylpyridine Suppplier: ChemScene
Price: 308.79 USD
AP3S1 Peptide[AP3S1] Suppplier: MyBioSource
Price: 5.87 USD
Hamster N Mid Osteocalcin ELISA Kit Suppplier: MyBioSource
Price: 5.87 USD
Human HYAL1 CRISPR Knock Out Cell Line Suppplier: ABM CrispR
Price: 6 834.44 USD
Setipafant 1mg Suppplier: ChemScene
Price: 1 979.53 USD
2-(2-(Trifluoromethyl)phenyl)ethanamine Suppplier: SFC
Price: 0.00 USD
Recombinant Cobyric acid synthase cobQ Suppplier: MyBioSource
Price: 0.00 USD
1.2 Dibromoethyl Suppplier: SFC
Price: 0.00 USD
Ask
Ajax processing
Close
C10orf54 cloning plasmid | Technique alternative | 010181417
Filters
EU:+32-(0)1-658-90-45 US:+1-(408)780-0908 [email protected]
  • C10orf54
  • cloning
Back
Contact us
Ajax processing
Close
Chat with gentaur.com employee