RAB34 cloning plasmid
-
Catalog numberCSB-CL319769HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the RAB34 gene.
-
SpecificationsGene name: RAB34; Gene ID: 83871; Accession number: BC066904; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 780; Sequence: atgaacattctggcacccgtgcggagggatcgcgtcctggcggagctgccccagtgcctgaggaaggaggccgctttgcacgggcacaaagacttccacccccgcgtcacctgcgcctgccaggagcaccggacaggcaccgtgggatttaagatctccaaggtcattgtggtgggggacctgtcggtggggaagacttgcctcattaataggttctgcaaagacacctttgataagaattacaaggccaccattggagtggacttcgagatggaacgatttgaggtgctgggcattcccttcagtttgcagctttgggataccgctgggcaggagaggttcaaatgcattgcatcaacctactatagaggagctcaagccatcatcattgtcttcaacctgaatgatgtggcatctctggaacataccaagcagtggctggccgatgccctgaaggagaatgacccttccagtgtgcttctcttccttgtaggttccaagaaggatctgagtacccctgctcagtatgcgctgatggagaaagacgccctccaggtggcccaggagatgaaggctgagtactgggcagtctcatctctcactggtgagaatgtccgagaattcttcttccgtgtggcagcactgacctttgaggccaatgtgctggctgagctggagaaatcgggggctcgacgcattggggatgttgtccgcatcaacagtgatgacaacaacctctacctaactgccagcaagaagaagcccacatgttgcccatga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolRAB34
-
Short nameRAB34 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameRAB34, member RAS oncogene family cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetRAB34, member RAS oncogene family, RAB34 and IDBG-37386 and ENSG00000109113 and 100861437,83871, guanyl nucleotide binding, nuclei, Rab34 and IDBG-202349 and ENSMUSG00000002059 and 19376, RAB34 and IDBG-631894 and ENSBTAG00000046129 and
-
Gene info
-
Identity
-
Gene
-
Long gene nameRAB34, member RAS oncogene family
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2001-09-14
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- RAB, member RAS oncogene GTPases
-
VEGA ID