pGB AIF siRNA Vector Mix

• Catalog number
  9511-20
• Price
  Please ask
• Size
  20 ug

• Description
  pGB expression vector to supress AIF apoptotic activity in transfected cells. pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. In addition, pGB Cloning vector which is used to clone your own insert and pGB Negative Control vector which contains an insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and therefore can be used as a negative control for pGB-expression vectors. The pGB siRNA vectors are designed to suppress the expression of some of the most important apoptosis genes, individually. The mix of four siRNA vectors for each gene has been proven more efficient for gene suppression.
• Product Highlights
  • GeneBlocker™ AIF siRNA Vector Mix • Application- The pGB siRNA vector Mix (1 µg/µl) can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003
• Storage Temp
  -20°C
• Shipping
  gel pack
• Shelf Life
  12 months
• Datasheet
• Notes
  For research use only. Not to be used for human or animal treatment or consumption.

• Gene target
  pGB   AIF   siRNA   Vector  
• Gene symbol
  AIF1, AIFM1
• Short name
  pGB AIF siRNA Vector
• Technique
  sirna, Vectors
• Alternative name
  pGB AIF small interfearing RNA integrating Desoxyribonucleic acid sequence Mix

Gene info

• Identity
  HGNC:352
• Gene
  AIF1
• Long gene name
  allograft inflammatory factor 1
• Synonyms
  • IRT-1
  • AIF-1
  • Em:AF129756.17
  • IBA1
• Synonyms name
  • interferon gamma responsive transcript
  • ionized calcium-binding adapter molecule 1
• GenBank acession
  • U19713
• Locus
  6p21.33
• Discovery year
  1997-07-01
• Entrez gene record
  199
• Pubmed identfication
  • 8912632
• Classification
  • EF-hand domain containing
• VEGA ID
  OTTHUMG00000031246

Gene info

• Identity
  HGNC:8768
• Gene
  AIFM1
• Long gene name
  apoptosis inducing factor mitochondria associated 1
• Synonyms gene
  • PDCD8
  • NAMSD
  • AUNX1
• Synonyms gene name
  • programmed cell death 8 (apoptosis-inducing factor)
  • neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)
  • apoptosis-inducing factor, mitochondrion-associated, 1
  • apoptosis inducing factor, mitochondria associated 1
  • auditory neuropathy, X-linked recessive 1
• Synonyms
  • AIF
  • CMTX4
  • DFNX5
• GenBank acession
  • AF100928
• Locus
  Xq26.1
• Discovery year
  1999-05-28
• Entrez gene record
  9131
• Pubmed identfication
  • 9989411
  • 23217327
  • 25986071
• VEGA ID
  OTTHUMG00000022392
• Locus Specific Databases
  • Global Variome shared LOVD

MeSH Data

• Name
  Transduction, Genetic
• Concept
  Scope note: The transfer of bacterial DNA by phages from an infected bacterium to another bacterium. This also refers to the transfer of genes into eukaryotic cells by viruses. This naturally occurring process is routinely employed as a GENE TRANSFER TECHNIQUE.
• Tree numbers
  • E05.393.350.800
• Qualifiers
  ethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data

Product images

Similar products