MARK4 cloning plasmid

• Catalog number
  CSB-CL013499HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the MARK4 gene.
• Specifications
  Gene name: MARK4; Gene ID: 57787; Accession number: BC009049; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 240; Sequence: atggcagctctgcgccaggccacagcagccgcccgctgccgctgccgccagccacagccgttcctgctggcctgcctgcacgggggtgcgggcgggcccgagcccctgtcccacttcgaagtggaggtctgccagctgccccggccaggcttgcggggagttctcttccgccgtgtggcgggcaccgccctggccttccgcaccctcgtcacccgcatctccaacgacctcgagctctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  MARK4   cloning  
• Gene symbol
  MARK4
• Short name
  MARK4 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  mitogen-stimulated protein kinase/microtubule affinity-regulating kinase 4 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  MAP/microtubule affinity-regulating kinase 4, MARK4 and IDBG-57219 and ENSG00000007047 and 57787, transferase activity, Cytoplasm, Mark4 and IDBG-150756 and ENSMUSG00000030397 and 232944, BT.43504 and IDBG-639417 and ENSBTAG00000002682 and 525675

Gene info

• Identity
  HGNC:13538
• Gene
  MARK4
• Long gene name
  microtubule affinity regulating kinase 4
• Synonyms gene
  • MARKL1
• Synonyms gene name
  • MAP/microtubule affinity-regulating kinase like 1
  • MAP/microtubule affinity-regulating kinase 4
• Synonyms
  • Nbla00650
  • FLJ90097
  • KIAA1860
  • PAR-1D
• GenBank acession
  • AB049127
• Locus
  19q13.32
• Discovery year
  2000-09-25
• Entrez gene record
  57787
• Pubmed identfication
  • 23400999
  • 11326310
  • 9108484
• RefSeq identity
  • NM_031417
• VEGA ID
  OTTHUMG00000181769

Similar products