BSG cloning plasmid
-
Catalog numberCSB-CL002831HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the BSG gene.
-
SpecificationsGene name: BSG; Gene ID: 682; Accession number: BC009040; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 810; Sequence: atggcggctgcgctgttcgtgctgctgggattcgcgctgctgggcacccacggagcctccggggctgccggcacagtcttcactaccgtagaagaccttggctccaagatactcctcacctgctccttgaatgacagcgccacagaggtcacagggcaccgctggctgaaggggggcgtggtgctgaaggaggatgcgctgcccggccagaaaacggagttcaaggtggactcggacgaccagtggggagagtactcctgcgtcttcctccccgagcccatgggcacggccaacatccagctccacgggcctcccagagtgaaggctgtgaagtcgtcagaacacatcaacgagggggagacggccatgctggtctgcaagtcagagtccgtgccacctgtcactgactgggcctggtacaagatcactgactctgaggacaaggccctcatgaacggctccgagagcaggttcttcgtgagttcctcgcagggccggtcagagctacacattgagaacctgaacatggaggccgaccccggccagtaccggtgcaacggcaccagctccaagggctccgaccaggccatcatcacgctccgcgtgcgcagccacctggccgccctctggcccttcctgggcatcgtggctgaggtgctggtgctggtcaccatcatcttcatctacgagaagcgccggaagcccgaggacgtcctggatgatgacgacgccggctctgcacccctgaagagcagcgggcagcaccagaatgacaaaggcaagaacgtccgccagaggaactcttcctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolBSG-AS1, BSG
-
Short nameBSG cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namebasigin (Ok blood group) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetbasigin (Ok blood group), 5F7 and CD147 and EMMPRIN and M6 and OK and TCSF, BSG and IDBG-12353 and ENSG00000172270 and 682, mannose binding, Plasma membranes, Bsg and IDBG-170502 and ENSMUSG00000023175 and 12215, BSG and IDBG-645483 and ENSBTAG00000016648 and 508716
-
Gene info
-
Identity
-
Gene
-
Long gene nameBSG antisense RNA 1
-
Locus
-
Discovery year2020-10-14
-
Entrez gene record
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene namebasigin (Ok blood group)
-
Synonyms gene
-
Synonyms gene name
- basigin
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1993-10-25
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Basigin family
- I-set domain containing
- Blood group antigens
- CD molecules
-
VEGA ID
-
Locus Specific Databases