FKBP14 cloning plasmid

• Catalog number
  CSB-CL865159HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the FKBP14 gene.
• Specifications
  Gene name: FKBP14; Gene ID: 55033; Accession number: BC005206; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 636; Sequence: atgaggcttttcttgtggaacgcggtcttgactctgttcgtcacttctttgattggggctttgatccctgaaccagaagtgaaaattgaagttctccagaagccattcatctgccatcgcaagaccaaaggaggggatttgatgttggtccactatgaaggctacttagaaaaggacggctccttatttcactccactcacaaacataacaatggtcagcccatttggtttaccctgggcatcctggaggctctcaaaggttgggaccagggcttgaaaggaatgtgtgtaggagagaagagaaagctcatcattcctcctgctctgggctatggaaaagaaggaaaaggtaaaattcccccagaaagtacactgatatttaatattgatctcctggagattcgaaatggaccaagatcccatgaatcattccaagaaatggatcttaatgatgactggaaactctctaaagatgaggttaaagcatatttaaagaaggagtttgaaaaacatggtgcggtggtgaatgaaagtcatcatgatgctttggtggaggatatttttgataaagaagatgaagacaaagatgggtttatatctgccagagaatttacatataaacacgatgagttatag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  FKBP14   cloning  
• Gene symbol
  FKBP14-AS1, FKBP14
• Short name
  FKBP14 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  FK506 binding protein 14, 22 kiloDalton cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  FK506 binding protein 14, 22 kDa, FKBP14 and IDBG-10945 and ENSG00000106080 and 55033, FK506 binding, Cytoplasm, Fkbp14 and IDBG-149031 and ENSMUSG00000038074 and 231997, FKBP14 and IDBG-633477 and ENSBTAG00000007870 and 615718

Gene info

• Identity
  HGNC:40990
• Gene
  FKBP14-AS1
• Long gene name
  FKBP14 antisense RNA 1
• Locus
  7p14.3
• Discovery year
  2020-03-19
• Entrez gene record
  105375215
• Classification
  • Antisense RNAs

Gene info

• Identity
  HGNC:18625
• Gene
  FKBP14
• Long gene name
  FKBP prolyl isomerase 14
• Synonyms gene name
  • FK506 binding protein 14 (22 kDa)
  • FK506 binding protein 14, 22 kDa
  • FK506 binding protein 14
• Synonyms
  • FLJ20731
  • FKBP22
• GenBank acession
  • AK000738
• Locus
  7p14.3
• Discovery year
  2002-06-05
• Entrez gene record
  55033
• Pubmed identfication
  • 12036304
  • 24821723
• RefSeq identity
  • NM_017946
• Classification
  • EF-hand domain containing
  • FKBP prolyl isomerases
• VEGA ID
  OTTHUMG00000023442
• Locus Specific Databases
  • LRG_454

Similar products