LAMA4 cloning plasmid
-
Catalog numberCSB-CL621948HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the LAMA4 gene.
-
SpecificationsGene name: LAMA4; Gene ID: 3910; Accession number: BC004241; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 363; Sequence: atggctttgagctcagcctggcgctcggttctgcctctgtggctcctctggagcgctgcctgctcccgcgccgcgtccggggacgacaacgcttttccttttgacattgaagggagctcagcggttggcaggcaagacccgcctgagacgagcgaaccccgcgtggctctgggacgcctgccgcctgcggccgaggtacagtgtccctgccattgccaccctgctggggcacctgcgcccccgcgggctgtgccacactcgtccttctctctctctccgcctctttcctctccccagtgccttgagagtttcacctgggctaggtcagttcggaaacttgaaataaagagttttcctttgtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolLAMA4-AS1, LAMA4
-
Short nameLAMA4 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namelaminin, alpha 4 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetlaminin, alpha 4, CMD1JJ and LAMA3 and LAMA4*-1, LAMA4 and IDBG-95551 and ENSG00000112769 and 3910, protein binding, Extracellular, Lama4 and IDBG-144145 and ENSMUSG00000019846 and 16775, LAMA4 and IDBG-631249 and ENSBTAG00000008817 and 529670
-
Gene info
-
Identity
-
Gene
-
Long gene nameLAMA4 antisense RNA 1
-
Locus
-
Discovery year2019-08-16
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene namelaminin subunit alpha 4
-
Synonyms gene name
- laminin, alpha 4
-
Synonyms
-
Locus
-
Discovery year1993-07-26
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Laminin subunits
-
VEGA ID
-
Locus Specific Databases