ATM cloning plasmid
-
Catalog numberCSB-CL618770HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ATM gene.
-
SpecificationsGene name: ATM; Gene ID: 472; Accession number: BC022307; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 396; Sequence: atgacgttacatgagccagcaaattctagtgccagtcagagcactgacctctgtgacttttcaggggatttggatcctgctcctaatccacctcattttccatcgcatgtgattaaagcaacatttgcctatatcagcaattgtcataaaaccaagttaaaaagcattttagaaattctttccaaaagccctgattcctatcagaaaattcttcttgccatatgtgagcaagcagctgaaacaaataatgtttataagaagcacagaattcttaaaatatatcacctgtttgttagtttattactgaaagatataaaaagtggcttaggaggagcttgggcctttgttcttcgagacgttatttatactttgattcactatatcaaccaaaggtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolATM
-
Short nameATM cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameataxia telangiectasia mutated cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetataxia telangiectasia mutated, AT1 and ATA and ATC and ATD and ATDC and ATE and TEL1 and TELO1, ATM and IDBG-70193 and ENSG00000149311 and 472, transferase activity, nuclei, Atm and IDBG-165511 and ENSMUSG00000034218 and 11920, ATM and IDBG-629882 and ENSBTAG00000003111 and 526824
-
Gene info
-
Identity
-
Gene
-
Long gene nameATM serine/threonine kinase
-
Synonyms gene
-
Synonyms gene name
- ataxia telangiectasia mutated (includes complementation groups A, C and D)
- ataxia telangiectasia mutated
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1995-07-07
-
Entrez gene record
-
RefSeq identity
-
Classification
- Armadillo like helical domain containing
-
VEGA ID
-
Locus Specific Databases