CCDC85B cloning plasmid

• Catalog number
  CSB-CL614902HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CCDC85B gene.
• Specifications
  Gene name: CCDC85B; Gene ID: 11007; Accession number: BC008796; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 609; Sequence: atggaggccgaggcaggcggcctggaggagctgacggacgaggagatggcggcgctaggcaaggaagagctagtgcggcgcctgcggcgggaggaggcggcgcgcctggcggcactggtgcagcgcggccgcctcatgcaggaggtgaatcggcagctgcagggccacctgggcgagatccgcgagctcaagcagctcaaccggcgtctgcaggcagagaaccgtgagctgcgcgacctctgctgcttcctggactcggagcgccagcgcgggcggcgcgccgcacgccagtggcagctcttcgggacccaagcatcccgggccgtgcgcgaggacctgggcggctgttggcagaagctggccgagctggagggccgccaggaggagctgctgcgggagaacctagcgcttaaggagctctgcctggcgctgggcgaagaatggggcccccgcggcggccccagcggcgccgggggatcaggagccgggccagcacccgagcttgccttgcccccgtgcgggccccgcgacctaggcgatggaagctccagcactggcagcgtgggcagtccggatcagttgcccctggcctgttcccccgatgattga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CCDC85B   cloning  
• Gene symbol
  CCDC85B
• Short name
  CCDC85B cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  coiled-coil domain containing 85B cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  coiled-coil domain containing 85B, DIPA, CCDC85B and IDBG-58028 and ENSG00000175602 and 11007, protein binding, nuclei, Ccdc85b and IDBG-702325 and ENSMUSG00000095098 and 240514, CCDC85B and IDBG-647994 and ENSBTAG00000005382 and 540332

Gene info

• Identity
  HGNC:24926
• Gene
  CCDC85B
• Long gene name
  coiled-coil domain containing 85B
• Synonyms
  • DIPA
• Synonyms name
  • hepatitis delta antigen interacting protein A
• GenBank acession
  • BC008796
• Locus
  11q13.1
• Discovery year
  2006-03-29
• Entrez gene record
  11007
• Pubmed identfication
  • 8810253
  • 15644333
  • 17873903
• RefSeq identity
  • NM_006848
• VEGA ID
  OTTHUMG00000166722

Similar products