ARRB1 cloning plasmid

• Catalog number
  CSB-CL002134HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the ARRB1 gene.
• Specifications
  Gene name: ARRB1; Gene ID: 408; Accession number: BC003636; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1257; Sequence: atgggcgacaaagggacccgagtgttcaagaaggccagtccaaatggaaagctcaccgtctacctgggaaagcgggactttgtggaccacatcgacctcgtggaccctgtggatggtgtggtcctggtggatcctgagtatctcaaagagcggagagtctatgtgacgctgacctgcgccttccgctatggccgggaggacctggatgtcctgggcctgacctttcgcaaggacctgtttgtggccaacgtacagtcgttcccaccggcccccgaggacaagaagcccctgacgcggctgcaggaacgcctcatcaagaagctgggcgagcacgcttaccctttcacctttgagatccctccaaaccttccatgttctgtgacactgcagccggggcccgaagacacggggaaggcttgcggtgtggactatgaagtcaaagccttctgcgcggagaatttggaggagaagatccacaagcggaattctgtgcgtctggtcatccggaaggttcagtatgccccagagaggcctggcccccagcccacagccgagaccaccaggcagttcctcatgtcggacaagcccttgcacctagaagcctctctggataaggagatctattaccatggagaacccatcagcgtcaacgtccacgtcaccaacaacaccaacaagacggtgaagaagatcaagatctcagtgcgccagtatgcagacatctgccttttcaacacagctcagtacaagtgccctgttgccatggaagaggctgatgacactgtggcacccagctcgacgttctgcaaggtctacacactgacccccttcctagccaataaccgagagaagcggggcctcgccttggacgggaagctcaagcacgaagacacgaacttggcctctagcaccctgttgagggaaggtgccaaccgtgagatcctggggatcattgtttcctacaaagtgaaagtgaagctggtggtgtctcggggcggcctgttgggagatcttgcatccagcgacgtggccgtggaactgcccttcaccctaatgcaccccaagcccaaagaggaacccccgcatcgggaagttccagagaacgagacgccagtagataccaatctcatagaacttgacacaaatgatgacgacattgtatttgaggactttgctcgccagagactgaaaggcatgaaggatgacaaggaggaagaggaggatggtaccggctctccacagctcaacaacagatag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  ARRB1   cloning  
• Gene symbol
  ARRB1
• Short name
  ARRB1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  arrestin, b 1 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  arrestin, beta 1, ARB1 and ARR1, ARRB1 and IDBG-64687 and ENSG00000137486 and 102724825,102724972,408, transcription regulatory region DNA binding, nuclei, Arrb1 and IDBG-200741 and ENSMUSG00000018909 and 109689, ARRB1 and IDBG-635576 and ENSBTAG00000020485 and 281637

Gene info

• Identity
  HGNC:711
• Gene
  ARRB1
• Long gene name
  arrestin beta 1
• Synonyms gene
  • ARR1
• Synonyms gene name
  • arrestin, beta 1
• Synonyms name
  • arrestin 2
• GenBank acession
  • BC003636
• Locus
  11q13.4
• Discovery year
  1994-01-10
• Entrez gene record
  408
• Pubmed identfication
  • 8486659
• RefSeq identity
  • NM_004041
• Classification
  • Classical arrestins
  • MicroRNA protein coding host genes
• VEGA ID
  OTTHUMG00000165444

Similar products