pGB BAX siRNA Vector Mix

• Catalog number
  9513-20
• Price
  Please ask
• Size
  20 μg

• Description
  pGB expression vector to supress BAX apoptotic activity in transfected cells. pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. In addition, pGB Cloning vector which is used to clone your own insert and pGB Negative Control vector which contains an insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and therefore can be used as a negative control for pGB-expression vectors. The pGB siRNA vectors are designed to suppress the expression of some of the most important apoptosis genes, individually. The mix of four siRNA vectors for each gene has been proven more efficient for gene suppression.
• Product Highlights
  • GeneBlocker™ BAX siRNA Vector Mix • Application- The pGB siRNA vector Mix (1 µg/µl) can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003
• Storage Temp
  -20°C
• Shipping
  gel pack
• Shelf Life
  12 months
• Datasheet
• Notes
  For research use only. Not to be used for human or animal treatment or consumption.

• Gene target
  pGB   BAX   siRNA   Vector  
• Gene symbol
  BAX
• Short name
  pGB BAX siRNA Vector
• Technique
  sirna, Vectors
• Alternative name
  pGB BCL2-associated X protein small interfearing RNA integrating Desoxyribonucleic acid sequence Mix
• Alternative to gene target
  BCL2-associated X protein, BCL2L4, BAX and IDBG-61459 and ENSG00000087088 and 581, BH3 domain binding, nuclei, Bax and IDBG-183241 and ENSMUSG00000003873 and 12028, BAX and IDBG-640344 and ENSBTAG00000013340 and 100850136,280730

Gene info

• Identity
  HGNC:959
• Gene
  BAX
• Long gene name
  BCL2 associated X, apoptosis regulator
• Synonyms gene name
  • BCL2-associated X protein
  • BCL2 associated X protein
• Synonyms
  • BCL2L4
• Locus
  19q13.33
• Discovery year
  1994-11-08
• Entrez gene record
  581
• Pubmed identfication
  • 8358790
• RefSeq identity
  • NM_138763
• Classification
  • BCL2 family
• VEGA ID
  OTTHUMG00000160476

MeSH Data

• Name
  Transduction, Genetic
• Concept
  Scope note: The transfer of bacterial DNA by phages from an infected bacterium to another bacterium. This also refers to the transfer of genes into eukaryotic cells by viruses. This naturally occurring process is routinely employed as a GENE TRANSFER TECHNIQUE.
• Tree numbers
  • E05.393.350.800
• Qualifiers
  ethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data

Product images

Similar products