HOXA5 cloning plasmid
-
Catalog numberCSB-CL010655HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the HOXA5 gene.
-
SpecificationsGene name: HOXA5; Gene ID: 3202; Accession number: BC013682; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 813; Sequence: atgagctcttattttgtaaactcattttgcggtcgctatccaaatggcccggactaccagttgcataattatggagatcatagttccgtgagcgagcaattcagggactcggcgagcatgcactccggcaggtacggctacggctacaatggcatggatctcagcgtcggccgctcgggctccggccactttggctccggagagcgcgcccgcagctacgctgccagcgccagcgcggcgcccgccgagcccaggtacagccagccggccacgtccacgcactctcctcagcccgatccgctgccctgctccgccgtggccccctcgcccggcagcgacagccaccacggcgggaaaaactccctaagcaactccagcggcgcctcggccgacgccggcagcacccacatcagcagcagagagggggttggcacggcgtccggagccgaggaggacgcccctgccagcagcgagcaggcgagtgcgcagagcgagccgagcccggcgccgcccgcccaaccccagatctacccctggatgcgcaagctgcacataagtcatgacaacataggcggcccggaaggcaaaagggcccggacggcctacacgcgctaccagaccctggagctggagaaggagttccacttcaaccgttacctgacccgcagaaggaggattgaaatagcacatgctctttgcctctccgagagacaaattaaaatctggttccaaaaccggagaatgaagtggaaaaaagataataagctgaaaagcatgagcatggccgcggcaggaggggccttccgtccctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolHOXA5
-
Short nameHOXA5 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namehomeobox A5 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targethomeobox A5, HOX1 and HOX1.3 and HOX1C, HOXA5 and IDBG-10422 and ENSG00000106004 and 3202, sequence-specific DNA binding, nuclei, Hoxa5 and IDBG-147940 and ENSMUSG00000038253 and 15402, HOXA5 and IDBG-633592 and ENSBTAG00000012211 and 768039
-
Gene info
-
Identity
-
Gene
-
Long gene namehomeobox A5
-
Synonyms gene
-
Synonyms gene name
- homeo box A5
-
Locus
-
Discovery year1990-06-15
-
Entrez gene record
-
Pubmed identfication
-
Classification
- HOXL subclass homeoboxes
-
VEGA ID