LAT2 cloning plasmid
-
Catalog numberCSB-CL872419HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the LAT2 gene.
-
SpecificationsGene name: LAT2; Gene ID: 7462; Accession number: BC001609; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 732; Sequence: atgagctcggggactgaactgctgtggcccggagcagcgctgctggtgctgttgggggtggcagccagtctgtgtgtgcgctgctcacgcccaggtgcaaagaggtcagagaaaatctaccagcagagaagtctgcgtgaggaccaacagagctttacggggtcccggacctactccttggtcgggcaggcatggccaggacccctggcggacatggcacccacaaggaaggacaagctgttgcaattctaccccagcctggaggatccagcatcttccaggtaccagaacttcagcaaaggaagcagacacgggtcggaggaagcctacatagaccccattgccatggagtattacaactgggggcggttctcgaagcccccagaagatgatgatgccaattcctacgagaatgtgctcatttgcaagcagaaaaccacagagacaggtgcccagcaggagggcataggtggcctctgcagaggggacctcagcctgtcactggccctgaagactggccccacttctggtctctgtccctctgcctccccggaagaagatgaggaatctgaggattatcagaactcagcatccatccatcagtggcgcgagtccaggaaggtcatggggcaactccagagagaagcatcccctggcccggtgggaagcccagacgaggaggacggggaaccggattacgtgaatggggaggtggcagccacagaagcctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolSLC7A8, LAT2
-
Short nameLAT2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namelinker to measure activation on T cells family, member 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetlinker for activation of T cells family, member 2, LAB and NTAL and WBSCR15 and WBSCR5 and WSCR5, LAT2 and IDBG-21069 and ENSG00000086730 and 7462, SH2 domain binding, Plasma membranes, Lat2 and IDBG-202957 and ENSMUSG00000040751 and 56743, BT.18889 and IDBG-639943 and ENSBTAG00000045767 and 505016
-
Gene info
-
Identity
-
Gene
-
Long gene namesolute carrier family 7 member 8
-
Synonyms gene name
- solute carrier family 7 (amino acid transporter light chain, L system), member 8
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-10-05
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Solute carriers
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namelinker for activation of T cells family member 2
-
Synonyms gene
-
Synonyms gene name
- Williams-Beuren syndrome chromosome region 5
- linker for activation of T cells family, member 2
- linker for activation of T-cells family member 2
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1997-09-12
-
Entrez gene record
-
Pubmed identfication
-
VEGA ID