PDLIM7 cloning plasmid
-
Catalog numberCSB-CL865112HU3-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PDLIM7 gene.
-
SpecificationsGene name: PDLIM7; Gene ID: 9260; Accession number: BC067806; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 576; Sequence: atggattccttcaaagtagtgctggaggggccagcaccttggggcttccggctgcaagggggcaaggacttcaatgtgcccctctccatttcccggctcactcctgggggcaaagcggcgcaggccggagtggccgtgggtgactgggtgctgagcatcgatggcgagaatgcgggtagcctcacacacatcgaagctcagaacaagatccgggcctgcggggagcgcctcagcctgggcctcagcagggcccagccggttcagagcaaaccgcagaaggcctccgcccccgccgcggaccctccgcggtacacctttgcacccagcgtctccctcaacaagacggcccggccctttggggcgcccccgcccgctgacagcgccccgcagcagaatggacagccgctccgacagctggtcccagatgccagcaagcagcggctgatggagaacacagaggactggcggccgcggccggggacaggccagtcgcgttccttccgcatccttgcccacctcacaggcaccgagttcatgcaagacccggatgaggagcacctgaagaaatcaagctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPDLIM7, PDLIM7-AS1
-
Short namePDLIM7 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namePDZ and LIM domain 7 (enigma) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetPDZ and LIM domain 7 (enigma), LMP1 and LMP3, PDLIM7 and IDBG-60188 and ENSG00000196923 and 9260, zinc ion binding, nuclei, Pdlim7 and IDBG-156136 and ENSMUSG00000021493 and 67399, PDLIM7 and IDBG-645273 and ENSBTAG00000007343 and 533851
-
Gene info
-
Identity
-
Gene
-
Long gene namePDZ and LIM domain 7
-
Synonyms gene name
- PDZ and LIM domain 7 (enigma)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2004-02-11
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- LIM domain containing
- PDZ domain containing
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namePDLIM7 antisense RNA 1
-
Locus
-
Discovery year2021-04-23
-
Classification
- Antisense RNAs