KIR3DX1 cloning plasmid
-
Catalog numberCSB-CL875690HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the KIR3DX1 gene.
-
SpecificationsGene name: KIR3DX1; Gene ID: 90011; Accession number: BC033195; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 237; Sequence: atggcaaacacagagcccacggaaggccaacggacggatgaagaggagcctgcagcagaagagacacaggagatcatatatgcccagttaaaccaccaggccctctcacagacaggattccctcctgcctcccagtgtccccactacctctcggaggatcctagtatctacatcactgtccaccaagcccaggctgaggccagagctgcccccagtctttggcacaaagggcattaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolKIR3DX1
-
Short nameKIR3DX1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namekiller cellular immunoglobulin-like receptor, three domains, X1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetkiller cell immunoglobulin-like receptor, three domains, X1, KIR3DX1 and IDBG-68797 and ENSG00000104970 and, protein binding, Extracellular
-
Gene info
-
Identity
-
Gene
-
Long gene namekiller cell immunoglobulin like receptor, three Ig domains X1 (pseudogene)
-
Synonyms gene
-
Synonyms gene name
- leukocyte receptor cluster (LRC) member 12
- killer cell immunoglobulin-like receptor, three domains, X1
- killer cell immunoglobulin like receptor, three Ig domains X1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2006-03-24
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Killer cell immunoglobulin like receptors
-
VEGA ID