YWHAE cloning plasmid
-
Catalog numberCSB-CL026287HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the YWHAE gene.
-
SpecificationsGene name: YWHAE; Gene ID: 7531; Accession number: BC000179; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 768; Sequence: atggatgatcgagaggatctggtgtaccaggcgaagctggccgagcaggctgagcgatacgacgaaatggtggagtcaatgaagaaagtagcagggatggatgtggagctgacagttgaagaaagaaacctcctatctgttgcatataagaatgtgattggagctagaagagcctcctggagaataatcagcagcattgaacagaaagaagaaaacaagggaggagaagacaagctaaaaatgattcgggaatatcggcaaatggttgagactgagctaaagttaatctgttgtgacattctggatgtactggacaaacacctcattccagcagctaacactggcgagtccaaggttttctattataaaatgaaaggggactaccacaggtatctggcagaatttgccacaggaaacgacaggaaggaggctgcggagaacagcctagtggcttataaagctgctagtgatattgcaatgacagaacttccaccaacgcatcctattcgcttaggtcttgctctcaatttttccgtattctactacgaaattcttaattcccctgaccgtgcctgcaggttggcaaaagcagcttttgatgatgcaattgcagaactggatacgctgagtgaagaaagctataaggactctacacttatcatgcagttgttacgtgataatctgacactatggacttcagacatgcagggtgacggtgaagagcagaataaagaagcgctgcaggacgtggaagacgaaaatcagtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolYWHAE
-
Short nameYWHAE cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide, 14-3-3E and HEL2 and KCIP-1 and MDCR and MDS, YWHAE and IDBG-14629 and ENSG00000108953 and 7531, phosphoprotein binding, Plasma membranes, Ywhae and IDBG-200597 and ENSMUSG00000020849 and 22627, YWHAE and IDBG-632682 and ENSBTAG00000005664 and 282125
-
Gene info
-
Identity
-
Gene
-
Long gene nametyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon
-
Synonyms gene name
- tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1993-09-20
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- 14-3-3 phospho-serine/phospho-threonine binding proteins
-
VEGA ID