CCL11 cloning plasmid
-
Catalog numberCSB-CL004775HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CCL11 gene.
-
SpecificationsGene name: CCL11; Gene ID: 6356; Accession number: BC017850; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 294; Sequence: atgaaggtctccgcagcacttctgtggctgctgctcatagcagctgccttcagcccccaggggctcgctgggccagcttctgtcccaaccacctgctgctttaacctggccaataggaagataccccttcagcgactagagagctacaggagaatcaccagtggcaaatgtccccagaaagctgtgatcttcaagaccaaactggccaaggatatctgtgccgaccccaagaagaagtgggtgcaggattccatgaagtatctggaccaaaaatctccaactccaaagccataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCCL11
-
Short nameCCL11 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C-C motif) ligand 11 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C-C motif) ligand 11, SCYA11, CCL11 and IDBG-40645 and ENSG00000172156 and 6356, chemokine activity, Extracellular, Ccl11 and IDBG-204519 and ENSMUSG00000020676 and 20292, CCL11 and IDBG-630948 and ENSBTAG00000004129 and 404072
-
Gene info
-
Identity
-
Gene
-
Long gene nameC-C motif chemokine ligand 11
-
Synonyms gene
-
Synonyms gene name
- small inducible cytokine subfamily A (Cys-Cys), member 11 (eotaxin)
- chemokine (C-C motif) ligand 11
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1996-04-24
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Chemokine ligands
-
VEGA ID