SIN3A cloning plasmid

  • Catalog number
    CSB-CL836303HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the SIN3A gene.
  • Specifications
    Gene name: SIN3A; Gene ID: 25942; Accession number: BC066364; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 471; Sequence: atgaagcggcgtttggatgaccaggagtcaccggtgtatgcagcccagcagcgtcggatccctggcagcacagaggcttttcctcaccagcaccgggtgcttgcccctgcccctcctgtgtatgaagcagtgtctgagaccatgcagtcagctacgggaattcagtactctgtaacacccagctaccaggtttcagccatgccacagagctccggcagtcatgggcccgctatagcagcagttcatagcagccatcatcacccaacagcggtgcagccccacggaggccaggtggtccagagtcatgctcatccagccccaccagttgcaccagtgcagggacagcagcaatttcagaggctgaaggtggtattcagctctttttcttgggtcaaaaaatttatctttagcaggaaatactggttgcagcttgttggttgtggtggtacaacttctaacctgagatactag
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    SIN3A   cloning  
  • Gene symbol
    SIN3A
  • Short name
    SIN3A cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    SIN3 transcription regulator homolog A (yeast) cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    SIN3 transcription regulator homolog A (yeast), SIN3A and IDBG-23397 and ENSG00000169375 and 25942, protein deacetylase activity, nuclei, Sin3a and IDBG-169269 and ENSMUSG00000042557 and 20466, SIN3A and IDBG-631394 and ENSBTAG00000009985 and 518504
Gene info
  • Identity
  • Gene
  • Long gene name
    SIN3 transcription regulator family member A
  • Synonyms gene name
    • SIN3 homolog A, transcription regulator (yeast)
    • SIN3 transcription regulator homolog A (yeast)
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2002-10-09
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • EMSY complex
    • SIN3 histone deacetylase complex subunits
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee