Filters
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing
Ajax processing

SPANXC cloning plasmid

SPANXC cloning plasmid is available 1 time from Cusabio labs

CSB-CL878921HU-10ug | SPANXC cloning plasmid size: 10ug | 273.57 USD

Catalog number CSB-CL878921HU-10ug
Supplier Cusabio
Price 273.57 USD
Size 10ug
1. Gene info
Identity 14331
Gene SPANXC
Long gene name SPANX family member C
Synonyms gene name
  • SPANX family, member C
Synonyms
  • CTp11
  • CT11.3
Synonyms name
  • cancer/testis antigen family 11, member 3
GenBank acession
  • AJ238277
Locus Xq27.2
Discovery year 2001-01-03
Entrez gene record 64663
Pubmed identfication
  • 10626816
RefSeq identity
  • NM_022661
Classification
  • SPANX family
Havana BLAST/BLAT OTTHUMG00000022556
Product images
    #.png
Product files
Description A cloning plasmid for the SPANXC gene.
Specifications Gene name: SPANXC; Gene ID: 64663; Accession number: BC054023; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Additional_information Formulation: 10 μg plasmid + 200μl Glycerol; Length: 294; Sequence: atggacaaacaatccagtgccggcggggtgaagaggagcgtcccctgtgaatccaacgaggtgaatgagacgatgccggagaccccaactggggactcagacccgcaacctgctcctaaaaaaatgaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaacgtgaaaagaacatctccagaggaactgctgaatgaccacgcccgagagaacagaatcaaccccctccaaatggaggaggaggaattcatggaaataatggttgaaatacctgcaaagtag
Storage_and_shipping Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
Notes For research use only.
Kit Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
Gene targetSPANXC cloning
Short name SPANXC cloning plasmid
Technique plasmid
Alternative name SPANXC cloning plasmid
Alternative technique plasmids
Similar products
Human TNNT3(Troponin T Type 3, Fast Skeletal) ELISA Kit Suppplier: ELK Biotech
Price: 713.85 USD
LY411575 50mg Suppplier: CSNpharm
Price: 655.15 USD
Anti-OTX1 + OTX2 (Polyclonal), ALEXA Fluor 594 Suppplier: Bioss Polyclonal Antibodies
Price: 574.13 USD
SIX6 Over-expression Lysate reagent Suppplier: genways
Price: 543.61 USD
SLCO1A1 Antibody Suppplier: aviva
Price: 497.82 USD
anti Mouse IgG H chain Antibody 0.5 Suppplier: acr
Price: 348.71 USD
4,7,10,13,16-Pentaoxanonadecanedioic Acid Suppplier: trca
Price: 314.66 USD
Kallikrein 5 KLK5 Polyclonal Antibody Mouse PE Suppplier: Cloud Clone Corp
Price: 221.90 USD
Cavy Osteoprotegerin ELISA Kit Suppplier: MyBioSource
Price: 5.87 USD
Monkey Angiotensin 1 ELISA Kit Suppplier: MyBioSource
Price: 5.87 USD
Phytoplasma mali Acetate kinase ackA Suppplier: MBS Recombinant
Price: 2 471.48 USD
ABX464 25mg Suppplier: ChemScene
Price: 1 467.63 USD
Parp16 3 UTR Luciferase Stable Cell Line Suppplier: ABM microrna
Price: 0.00 USD
Recombinant Dog Gastrin Suppplier: MyBioSource
Price: 0.00 USD
Ask
Ajax processing
Close
SPANXC cloning plasmid | Technique alternative | 01018144158
Filters
EU:+32-(0)1-658-90-45 US:+1-(408)780-0908 [email protected]
  • SPANXC
  • cloning
Back
Contact us
Ajax processing
Close
Chat with gentaur.com employee