CLN8 cloning plasmid
-
Catalog numberCSB-CL866210HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CLN8 gene.
-
SpecificationsGene name: CLN8; Gene ID: 2055; Accession number: BC007725; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 861; Sequence: atgaatcctgcgagcgatgggggcacatcagagagcatttttgacctggactatgcatcctgggggatccgctccacgctgatggtcgctggctttgtcttctacttgggcgtctttgtggtctgccaccagctgtcctcttccctgaatgccacttaccgttctttggtggccagagagaaggtcttctgggacctggcggccacgcgtgcagtctttggtgttcagagcacagccgcaggcctgtgggctctgctgggggaccctgtgctgcatgccgacaaggcgcgtggccagcagaactggtgctggtttcacatcacgacagcaacgggattcttttgctttgaaaatgttgcagtccacctgtccaacttgatcttccggacatttgacttgtttctggttatccaccatctctttgcctttcttgggtttcttggctgcttggtcaatctccaagctggccactatctagctatgaccacgttgctcctggagatgagcacgccctttacctgcgtttcctggatgctcttaaaggcgggctggtccgagtctctgttttggaagctcaaccagtggctgatgattcacatgtttcactgccgcatggttctaacctaccacatgtggtgggtgtgtttctggcactgggacggcctggtcagcagcctgtatctgcctcatttgacactgttccttgtcggactggctctgcttacgctaatcattaatccatattggacccataagaagactcagcagcttctcaatccggtggactggaacttcgcacagccagaagccaagagcaggccagaaggcaacgggcagctgctgcggaagaagaggccatag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCLN8-AS1, CLN8
-
Short nameCLN8 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation), C8orf61 and EPMR, CLN8 and IDBG-5421 and ENSG00000182372 and 2055, Plasma membranes, Cln8 and IDBG-136384 and ENSMUSG00000026317 and 26889, CLN8 and IDBG-628376 and ENSBTAG00000008584 and 530874
-
Gene info
-
Identity
-
Gene
-
Long gene nameCLN8 antisense RNA 1
-
Locus
-
Discovery year2021-03-18
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene nameCLN8 transmembrane ER and ERGIC protein
-
Synonyms gene
-
Synonyms gene name
- chromosome 8 open reading frame 61
- epilepsy, progressive with mental retardation
- ceroid-lipofuscinosis, neuronal 8
- CLN8, transmembrane ER and ERGIC protein
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1993-12-15
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- TLC domain containing
-
VEGA ID
-
Locus Specific Databases