CD40LG cloning plasmid

• Catalog number
  CSB-CL004937HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CD40LG gene.
• Specifications
  Gene name: CD40LG; Gene ID: 959; Accession number: BC071754; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 786; Sequence: atgatcgaaacatacaaccaaacttctccccgatctgcggccactggactgcccatcagcatgaaaatttttatgtatttacttactgtttttcttatcacccagatgattgggtcagcactttttgctgtgtatcttcatagaaggttggacaagatagaagatgaaaggaatcttcatgaagattttgtattcatgaaaacgatacagagatgcaacacaggagaaagatccttatccttactgaactgtgaggagattaaaagccagtttgaaggctttgtgaaggatataatgttaaacaaagaggagacgaagaaagaaaacagctttgaaatgcaaaaaggtgatcagaatcctcaaattgcggcacatgtcataagtgaggccagcagtaaaacaacatctgtgttacagtgggctgaaaaaggatactacaccatgagcaacaacttggtaaccctggaaaatgggaaacagctgaccgttaaaagacaaggactctattatatctatgcccaagtcaccttctgttccaatcgggaagcttcgagtcaagctccatttatagccagcctctgcctaaagtcccccggtagattcgagagaatcttactcagagctgcaaatacccacagttccgccaaaccttgcgggcaacaatccattcacttgggaggagtatttgaattgcaaccaggtgcttcggtgtttgtcaatgtgactgatccaagccaagtgagccatggcactggcttcacgtcctttggcttactcaaactctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CD40LG   cloning  
• Gene symbol
  CD40LG
• Short name
  CD40LG cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  CD40 molecule, tumor necrosis factor receptor superfamily member 5 ligand cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  CD40 ligand, CD154 and CD40L and gp39 and hCD40L and HIGM1 and IGM and IMD3 and T-BAM and TNFSF5 and TRAP, CD40LG and IDBG-87653 and ENSG00000102245 and 959, protein binding, Extracellular, Cd40lg and IDBG-147440 and ENSMUSG00000031132 and 21947, CD40LG and IDBG-631246 and ENSBTAG00000017843 and 282387

Gene info

• Identity
  HGNC:11935
• Gene
  CD40LG
• Long gene name
  CD40 ligand
• Synonyms gene
  • HIGM1
  • IMD3
  • TNFSF5
• Synonyms gene name
  • tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome)
• Synonyms
  • CD40L
  • TRAP
  • gp39
  • hCD40L
  • CD154
• Synonyms name
  • CD40 antigen ligand
  • tumor necrosis factor (ligand) superfamily member 5
  • T-B cell-activating molecule
  • TNF-related activation protein
  • hyper-IgM syndrome
• GenBank acession
  • X67878
• Locus
  Xq26.3
• Discovery year
  1989-06-30
• Entrez gene record
  959
• Pubmed identfication
  • 1427881
  • 7678782
• RefSeq identity
  • NM_000074
• Classification
  • CD molecules
  • Tumor necrosis factor superfamily
• VEGA ID
  OTTHUMG00000022512
• Locus Specific Databases
  • CD40Lbase: Mutation registry for X-linked Hyper-IgM syndrome
  • Global Variome shared LOVD
  • LRG_141

MeSH Data

• Name
  CD4 Lymphocyte Count
• Concept
  Scope note: The number of CD4-POSITIVE T-LYMPHOCYTES per unit volume of BLOOD. Determination requires the use of a fluorescence-activated flow cytometer.
• Tree numbers
  • E01.370.225.500.195.107.595.500.150
  • E01.370.225.625.107.595.500.150
  • E05.200.500.195.107.595.500.150
  • E05.200.625.107.595.500.150
  • E05.242.195.107.595.500.150
• Qualifiers
  ethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data

Similar products