PRUNE2 cloning plasmid
-
Catalog numberCSB-CL848821HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PRUNE2 gene.
-
SpecificationsGene name: PRUNE2; Gene ID: 158471; Accession number: BC019095; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 780; Sequence: atggaagaatttttgcaacgcgccaaatctaaactgaatcgaagcaaacgcttggagaaggtccatgtggttattgggcctaaatcgtgtgacttggattctctcatttctaccttcacatatgcttactttctagacaaggtcagtccaccaggggttctgtgtttaccagtgctgaacataccaagaactgaattcaactacttcaccgagacgaggtttattttagaagagctaaatatttccgaatcattccacatattccgggatgaaattaacctgcatcagctaaatgatgaagggaagttatcgataacacttgttggcagcagtgtgctggcgagtgaagacaaaactttagaatcagcagttgtcaaagtcattaatccggttgagcagagcgatgccaacgttgagttccgagagtcttcctcttctctcgtgctaaaggagattctccaagaggctcctgagctcatcaccgagcaactggctcatcgcctcagaggtagcattcttttcaagtggatgaccatggaatcagagaagatctcagagaagcaggaggaaattctttctatcctggaagaaaaatttcctaacttgcctccaagagaggacatcatcaacgtcctacaggagacccagttcagtgctcagggtttaagtattgaacagacaatgttgaaagatctaaaggagctgtcagatggagaaataaaagtggccattagtactgtgagcatgaaccttgaggtaagggtgggaatgcttttttag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPCA3, PRUNE2
-
Short namePRUNE2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameprune homolog 2 (Drosophila) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetprune homolog 2 (Drosophila), PRUNE2 and IDBG-72044 and ENSG00000106772 and 158471, metal ion binding, Cytoplasm, Prune2 and IDBG-150591 and ENSMUSG00000039126 and 353211, PRUNE2 and IDBG-632481 and ENSBTAG00000012991 and 518308
-
Gene info
-
Identity
-
Gene
-
Long gene nameprostate cancer associated 3
-
Synonyms gene name
- prostate cancer antigen 3
- prostate cancer antigen 3 (non-protein coding)
- prostate cancer associated 3 (non-protein coding)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2000-06-08
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Long non-coding RNAs with non-systematic symbols
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameprune homolog 2 with BCH domain
-
Synonyms gene
-
Synonyms gene name
- chromosome 9 open reading frame 65
- KIAA0367
- prune homolog 2 (Drosophila)
- prune homolog 2
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2004-01-06
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- BCH domain containing
-
VEGA ID